[Talkwalker Alerts] Alert for translate

Tell a Friend

Latest News from our blog: Why use speech analytics tools

If you like our Alerts, please help us keep this service free by liking and following!

News 50 new results

Will lessons learned from this pandemic soften the blow during the next one? ...live in less expensive places than the cities where they once labored. That could translate into less traffic. Telemedicine is here to stay as well, enabling people in remote places to access basic care. The pandemic also laid bare long-festering... 25/04/21 23:00 | United States | pasadenastarnews.com Tweet

Will lessons learned from this pandemic soften the blow during the next one? ...live in less expensive places than the cities where they once labored. That could translate into less traffic. Telemedicine is here to stay as well, enabling people in remote places to access basic care. The pandemic also laid bare long-festering... 25/04/21 23:00 | United States | pe.com Tweet

Will lessons learned from this pandemic soften the blow during the next one? ...live in less expensive places than the cities where they once labored. That could translate into less traffic. Telemedicine is here to stay as well, enabling people in remote places to access basic care. The pandemic also laid bare long-festering... 25/04/21 23:00 | United States | dailybreeze.com Tweet

Will lessons learned from this pandemic soften the blow during the next one? ...live in less expensive places than the cities where they once labored. That could translate into less traffic. Telemedicine is here to stay as well, enabling people in remote places to access basic care. The pandemic also laid bare long-festering... 25/04/21 23:00 | United States | redlandsdailyfacts.com Tweet

Will lessons learned from this pandemic soften the blow during the next one? ...live in less expensive places than the cities where they once labored. That could translate into less traffic. Telemedicine is here to stay as well, enabling people in remote places to access basic care. The pandemic also laid bare long-festering... 25/04/21 23:00 | United States | sbsun.com Tweet

Will lessons learned from this pandemic soften the blow during the next one? ...live in less expensive places than the cities where they once labored. That could translate into less traffic. Telemedicine is here to stay as well, enabling people in remote places to access basic care. The pandemic also laid bare long-festering... 25/04/21 23:00 | United States | ocregister.com Tweet

Will lessons learned from this pandemic soften the blow during the next one? ...live in less expensive places than the cities where they once labored. That could translate into less traffic. Telemedicine is here to stay as well, enabling people in remote places to access basic care. The pandemic also laid bare long-festering... 25/04/21 23:00 | United States | sgvtribune.com Tweet

Will lessons learned from this pandemic soften the blow during the next one? ...live in less expensive places than the cities where they once labored. That could translate into less traffic. Telemedicine is here to stay as well, enabling people in remote places to access basic care. The pandemic also laid bare long-festering... 25/04/21 23:00 | United States | dailybulletin.com Tweet

Will lessons learned from this pandemic soften the blow during the next one? ...live in less expensive places than the cities where they once labored. That could translate into less traffic. Telemedicine is here to stay as well, enabling people in remote places to receive much better care. The pandemic also laid bare... 25/04/21 23:00 | United States | mercurynews.com Tweet

FDA set to scrutinize unproven cancer drugs after 10-year gap approves dozens of new uses for cancer drugs based on early signs that they can shrink or slow the spread of tumors. But how often do those initial results translate into longer, healthier lives for patients? That seemingly simple question is one... 25/04/21 22:54 | United States | kagstv.com Tweet

FDA set to scrutinize unproven cancer drugs after 10-year gap approves dozens of new uses for cancer drugs based on early signs that they can shrink or slow the spread of tumors. But how often do those initial results translate into longer, healthier lives for patients? That seemingly simple question is one... 25/04/21 22:54 | United States | ktvb.com Tweet

The Wales team that barely stands a chance right now amid mysterious exits, crushing results and... ...but growth in this area alone won't translate into benefits for the national team for a long while yet. As for domestic... 25/04/21 22:38 | United Kingdom | walesonline.co.uk Tweet

Asus ROG Phone 5 Review: Pushing The Limits Of Performance And Innovation In A Smartphone The ROG Phone 5 brings several improvements across the board. But how did these improvements translate to real-world usage, well, let's find out? Design When it comes to design and build, not much seems to have changed from past ROG Phones. While... 25/04/21 22:26 | India | moneycontrol.com Tweet

Has Caserio Created Too Much Houston Texans Turnover? NFL Draft Tracker - Sports Illustrated Houston... ...won't cut it. Not the flashiest back, but you can guarantee his toughness will translate well to the NFL. 184 - Shi Smith - Wide Receiver, South Carolina A Senior Bowl standout, Smith isn't the tallest of receivers at 5-10 but what he lacks in... 25/04/21 22:23 | United States | si.com Tweet

Ground broken for Round Prairie Elders Lodge in Saskatoon ...and overall space planning ideas that we have learned about over the years and translate certain aspects in a contemporary way. We were truly honoured to have this opportunity to try to respect the traditional Métis ways while honouring our... 25/04/21 22:22 | Canada | eaglefeathernews.com Tweet

Leaders Summit: The Energy Transition Priorities Needed for a 1.5°C Future ...replaced in the next three decades to translate this vision into a reality. Success is far from guaranteed, but this should... 25/04/21 22:20 | France | marketscreener.com Tweet

Here's The Skinny 40 Years Later: The Drafting Of Cris Collinsworth ...an endless network of conditioning contacts and in 1981 he knew the photo didn't translate. Collinsworth's strength coach at Florida told Wood that the kid was muscular enough to have been named to an All-American strength team. "Lindy was from... 25/04/21 22:08 | United States | bengals.com Tweet

The simple pleasure of gardening during the pandemic. It's hard to relate my own little mostly paved plot to the projects on dozens or hundreds of acres that they work on, but some of their ideas do translate—the notion, for example, that a landscape design is always changing. Unlike the furniture or... 25/04/21 22:00 | United States | montereycountyweekly.com Tweet

Artist of the Year 2021: Computer-assisted visual arts semifinalists – Orange County Register Additionally, I believe an artist takes their personal thoughts that they are unable to verbally communicate and instead, they translate those thoughts into a visual format for others to interpret." Diana Valdivia, junior, Cypress High... 25/04/21 21:54 | United States | ocregister.com Tweet

FDA set to scrutinize unproven cancer drugs after 10-year gap approves dozens of new uses for cancer drugs based on early signs that they can shrink or slow the spread of tumors. But how often do those initial results translate into longer, healthier lives for patients? That seemingly simple question is one... 25/04/21 21:54 | United States | wusa9.com Tweet

FDA set to scrutinize unproven cancer drugs after 10-year gap approves dozens of new uses for cancer drugs based on early signs that they can shrink or slow the spread of tumors. But how often do those initial results translate into longer, healthier lives for patients? That seemingly simple question is one... 25/04/21 21:54 | United States | kgw.com Tweet

FDA set to scrutinize unproven cancer drugs after 10-year gap approves dozens of new uses for cancer drugs based on early signs that they can shrink or slow the spread of tumors. But how often do those initial results translate into longer, healthier lives for patients? That seemingly simple question is one... 25/04/21 21:54 | United States | 11alive.com Tweet

FDA set to scrutinize unproven cancer drugs after 10-year gap approves dozens of new uses for cancer drugs based on early signs that they can shrink or slow the spread of tumors. But how often do those initial results translate into longer, healthier lives for patients? That seemingly simple question is one... 25/04/21 21:54 | United States | whas11.com Tweet

FDA set to scrutinize unproven cancer drugs after 10-year gap approves dozens of new uses for cancer drugs based on early signs that they can shrink or slow the spread of tumors. But how often do those initial results translate into longer, healthier lives for patients? That seemingly simple question is one... 25/04/21 21:54 | United States | 12newsnow.com Tweet

FDA set to scrutinize unproven cancer drugs after 10-year gap approves dozens of new uses for cancer drugs based on early signs that they can shrink or slow the spread of tumors. But how often do those initial results translate into longer, healthier lives for patients? That seemingly simple question is one... 25/04/21 21:54 | United States | fox61.com Tweet

FDA set to scrutinize unproven cancer drugs after 10-year gap approves dozens of new uses for cancer drugs based on early signs that they can shrink or slow the spread of tumors. But how often do those initial results translate into longer, healthier lives for patients? That seemingly simple question is one... 25/04/21 21:54 | United States | wltx.com Tweet

FDA set to scrutinize unproven cancer drugs after 10-year gap approves dozens of new uses for cancer drugs based on early signs that they can shrink or slow the spread of tumors. But how often do those initial results translate into longer, healthier lives for patients? That seemingly simple question is one... 25/04/21 21:54 | United States | wzzm13.com Tweet

FDA set to scrutinize unproven cancer drugs after 10-year gap approves dozens of new uses for cancer drugs based on early signs that they can shrink or slow the spread of tumors. But how often do those initial results translate into longer, healthier lives for patients? That seemingly simple question is one... 25/04/21 21:54 | United States | wqad.com Tweet

FDA set to scrutinize unproven cancer drugs after 10-year gap approves dozens of new uses for cancer drugs based on early signs that they can shrink or slow the spread of tumors. But how often do those initial results translate into longer, healthier lives for patients? That seemingly simple question is one... 25/04/21 21:54 | United States | wfmynews2.com Tweet

FDA set to scrutinize unproven cancer drugs after 10-year gap approves dozens of new uses for cancer drugs based on early signs that they can shrink or slow the spread of tumors. But how often do those initial results translate into longer, healthier lives for patients? That seemingly simple question is one... 25/04/21 21:54 | United States | kiiitv.com Tweet

In Iraqi Kurdistan, book clubs and science fiction offer 'escape' ...novels into Danish, English and Farsi. "It is extremely difficult and costly to translate and introduce Kurdish literature to the world, but it is a dream and we want to achieve it," Nusyar founder Alan Pary, himself a poet and translator, told... 25/04/21 21:48 | Kuwait | news.kuwaittimes.net Tweet

FDA to scrutinize unproven cancer drugs after 10-year gap approves dozens of new uses for cancer drugs based on early signs that they can shrink or slow the spread of tumors. But how often do those initial results translate into longer, healthier lives for patients? That seemingly simple question is one... 25/04/21 21:33 | United States | wral.com Tweet

FDA to scrutinize unproven cancer drugs after 10-year gap approves dozens of new uses for cancer drugs based on early signs that they can shrink or slow the spread of tumors. But how often do those initial results translate into longer, healthier lives for patients? That seemingly simple question is one... 25/04/21 21:33 | United States | clickorlando.com Tweet

FDA to scrutinize unproven cancer drugs after 10-year gap approves dozens of new uses for cancer drugs based on early signs that they can shrink or slow the spread of tumors. But how often do those initial results translate into longer, healthier lives for patients? That seemingly simple question is one... 25/04/21 21:33 | United States | local10.com Tweet

FDA to scrutinize unproven cancer drugs after 10-year gap approves dozens of new uses for cancer drugs based on early signs that they can shrink or slow the spread of tumors. But how often do those initial results translate into longer, healthier lives for patients? That seemingly simple question is one... 25/04/21 21:33 | United States | clickondetroit.com Tweet

Remembering Maulana Wahiduddin Khan Humein use chidiya ki tarhan hona chahiye jo toofan ke badlon ke oopar udna seekh le." To translate: "There will always be storms in life. We have to strive to be like the bird that learns to fly above the storm clouds." In the years that followed... 25/04/21 21:31 | India | indianexpress.com Tweet

FDA to scrutinize unproven cancer drugs after 10-year gap approves dozens of new uses for cancer drugs based on early signs that they can shrink or slow the spread of tumors. But how often do those initial results translate into longer, healthier lives for patients? That seemingly simple question is one... 25/04/21 21:05 | United States | wsvn.com Tweet

Habitation on Hibernia: Literal LEGO Worldbuilding ...us uninitiated about Hibernia, what is it, how does it work, and how does that translate into MOCs by the community? In a nutshell, (a big one) Hibernia is an ice planet, technically a moon orbiting a gas giant similar to Jupiter. It's the first... 25/04/21 21:00 | United States | bricknerd.com Tweet

Banking, metals, pharma & FMCG to show earning growth this year: Anand Tandon There is definitely going to be an improvement over the last several years but that will not necessarily translate into a huge upside for many of these companies if you were to keep an eye on the valuations. We have to look down the curve a little... 25/04/21 20:56 | India | economictimes.indiatimes.com Tweet

Bilingual novel delves into 1960s Singapore For a few years, I had listened to my mother talk about this project extensively, and once I read it, I knew I had to translate it." During a discussion at the launch, Mrs Kamaladevi shared snippets of old-school romance she experienced and spoke... 25/04/21 20:46 | Singapore | straitstimes.com Tweet

FDA to scrutinize unproven cancer drugs after 10-year gap approves dozens of new uses for cancer drugs based on early signs that they can shrink or slow the spread of tumors. But how often do those initial results translate into longer, healthier lives for patients? That seemingly simple question is one... 25/04/21 20:33 | United States | wokv.com Tweet

Tower Of Babble: Non-Native Speakers Navigate The World Of 'Good' And 'Bad' English ...joy for Harb. "I haven't yet encountered a person who can tell me, 'Yeah, if you translate that directly, it's a common phrase in my language.'" English cultivated among non-native speakers can include useful modifications and creative new turns of... 25/04/21 20:15 | United States | radio.wcmu.org Tweet

Ed's 6-round Giants mock draft: A predictable first couple of rounds for New York Overall, Rountree might not have any special traits, but he is reliable, and the strengths of his game (vision, footwork, toughness) translate well to any scheme. He projects as a potential backup if he proves to be reliable in third-down... 25/04/21 20:00 | United States | bigblueview.com Tweet

Tower Of Babble: Non-Native Speakers Navigate The World Of 'Good' And 'Bad' English ...joy for Harb. "I haven't yet encountered a person who can tell me, 'Yeah, if you translate that directly, it's a common phrase in my language.'" English cultivated among non-native speakers can include useful modifications and creative new turns of... 25/04/21 19:53 | United States | wfdd.org Tweet

FDA to scrutinize unproven cancer drugs after 10-year gap approves dozens of new uses for cancer drugs based on early signs that they can shrink or slow the spread of tumors. But how often do those initial results translate into longer, healthier lives for patients? That seemingly simple question is one... 25/04/21 19:31 | United States | apnews.com Tweet

Tower Of Babble: Non-Native Speakers Navigate The World Of 'Good' And 'Bad' English ...joy for Harb. "I haven't yet encountered a person who can tell me, 'Yeah, if you translate that directly, it's a common phrase in my language.'" English cultivated among non-native speakers can include useful modifications and creative new turns of... 25/04/21 19:31 | United States | wlrn.org Tweet

KC Chiefs: 7-round mock draft after the Orlando Brown trade ...learning from Hill, and Hardman, he could translate into a big weapon in a couple years.rn Conclusion rnThe Chiefs have a... 25/04/21 15:00 | United Kingdom | arrowheadaddict.com Tweet

FDA to scrutinize unproven cancer drugs after 10-year gap approves dozens of new uses for cancer drugs based on early signs that they can shrink or slow the spread of tumors. But how often do those initial results translate into longer, healthier lives for patients? That seemingly simple question is one... 25/04/21 14:38 | United States | wkrg.com Tweet

FDA to scrutinize unproven cancer drugs after 10-year gap approves dozens of new uses for cancer drugs based on early signs that they can shrink or slow the spread of tumors. But how often do those initial results translate into longer, healthier lives for patients? That seemingly simple question is one... 25/04/21 13:37 | United States | abc4.com Tweet

FDA to scrutinize unproven cancer drugs after 10-year gap approves dozens of new uses for cancer drugs based on early signs that they can shrink or slow the spread of tumors. But how often do those initial results translate into longer, healthier lives for patients? That seemingly simple question is one... 25/04/21 12:33 | United States | seattletimes.com Tweet

Twitter 50 new results

Ryan Chase There have been 159 mass shootings in 2021. 24,092 people shot this year overall. 2020 was a record breaking year in gun sales. More guns on our streets will translate to many more deaths for years to come. This problem will only continue to get worse unless we act! #GunReform https://t.co/ZnriE78Zhd 25/04/21 23:18 | United States | twitter.com Tweet

Nuna_Kana/KTH1 Big Thanks for our Translator : @BsideGulf @daisybboee @ifgysb @knwclouds @Vtm_gulf without them we would not have felt this close to Gulf. Thank you for working hard to translate and be a bridge for us to be able to understand all Gulf said 🙏 @gulfkanawut #รักนะทีมกลัฟจากลูกบอล 25/04/21 23:12 | United States | twitter.com Tweet

Soboking JimPD¹³ I also wonder why she picked that article in English. There were so many articles in Korean. It's not like she can't read korean. She never wanted to translate Jm's articles but suddenly let's quote one from English ~ 25/04/21 23:09 | United States | twitter.com Tweet

nana thank you weverse translate https://t.co/joRryMXQhp 25/04/21 23:09 | United States | twitter.com Tweet

NicKiE ✍���� Do you know why ShinEunKyuYe chose MAHAL KITA amongst all I LOVE YOU languages? coz it may also translate "BIG PROFIT" in tagalog language.. SJ really knew their business.. hahaha #SUPERJUNIOR #ELFJAPAN #The_SUPER_Blue_Party 25/04/21 23:09 | Philippines | twitter.com Tweet

Dyva�� Some people requested me to translate this, I did before but I couldn't find the tweet so I'll translate again ㅠ so this was back in 2018, OP and their friend (likes kpop) saw Jungwoo and Doyoung at a cafe and their table was close to them so they could hear the conversation+ https://t.co/eFjs7TSy5r 25/04/21 23:08 | United States | twitter.com Tweet

✜⁵TXT MOA INA���� Klo admin yg translate jadi bakalan jadi : "Lagu [title track] untuk comeback nanti bagus banget hihi" 👀 25/04/21 23:04 | Indonesia | twitter.com Tweet

hana�� (kinda ia) imma translate basically this post shared about jaehyun's skincare and such and this flop artist commented saying "did you think that bcs of plastic surgery they dont grow acne..god" in a really disrespectful way implying that he had plastic surgery..report her acc @/imantroye 👀 https://t.co/9rasgJJkn9 25/04/21 23:01 | Malaysia | twitter.com Tweet

Proud Sabres Fan @colegoalfield because he was good as a player so obviously that will translate to management bc logic 25/04/21 22:56 | United States | twitter.com Tweet

_imaizeeey_⁷�� You know what? Okay. Bora wasn't the only who spoken about hanbok auction. It was other ARMY as well. It's targeting harassment, bullying and dts from all sides because, she is outspoken? She doesn't translate often but, my god...this isn't it. 25/04/21 22:56 | United States | twitter.com Tweet

AtinyLinks (slow) If you are interested in helping translate the template from Chi to Eng or Eng to Chi please DM!! 25/04/21 22:51 | United States | twitter.com Tweet

candide ⁷ �� @Opulent_Jimin 1. There was never a mention of charity. The money would go to private individuals. 2. Body Odor was literally used by Myart, the auction company, during their media press for the hanbok. 3. We read the article in english. Bora did not translate or influence us. https://t.co/W0om2TYoDY 25/04/21 22:50 | United States | twitter.com Tweet

ᵈᵉᵉ ❣◕ ‿ ◕❣ ¹⁷¹⁹ Thank you pb translator @BsideGulf @Vtm_gulf @knwclouds @ifgysb for taking your precious time to translate gulf's content, without all of you, we (inter pb) are lost 🥺🤧 #รักนะทีมกลัฟจากลูกบอล 25/04/21 22:47 | United States | twitter.com Tweet

PG | เปงหม่ามี๊���� ft.INTO1-OT11 อัน​แปล​จาก translate นะ​คะ #ZhouKeYu https://t.co/qngetc0Zjd 25/04/21 22:30 | Thailand | twitter.com Tweet

������Grace⁷ Here's my first ever entry for #WordsByBangtan 🥺👉👈 all credits are in the photos; the second photo is a Filipino re-interpretation (not a direct translation) of the lyrics of Butterfly. I recently find it therapeutic to translate/re-interpret BTS lyrics in my Native Tongue 💜 https://t.co/6hwslCX2YP 25/04/21 22:26 | Philippines | twitter.com Tweet

fides.�� @Hanbokchris @rachahyuns no they actually thought she started the rumor when all she did was translate an article?!? 25/04/21 22:20 | United States | twitter.com Tweet

Miss Cromatina CACGCCCCCCCCTATGACAACGCCGACGCCTAT [Translate sequence] 5'3' Frame 1 H A P P Y D N A D A Y 🧬🥳 https://t.co/jYpV44RhLj 25/04/21 22:20 | Mexico | twitter.com Tweet

sushi⁵ • �� 光点 • dreaming of xiao zhan excerpt of that repo posted here: #XiaoZhan #ADreamwithXiaoZhan https://t.co/viEWHLZgOQ (you can open this link on chrome and auto translate) https://t.co/Vxgye1JMRF 25/04/21 22:17 | Philippines | twitter.com Tweet

Nhlakanipho Mkhize Nandi uyagula kodwa angazi uphethwe yini. Ngizomphuphutha isilonda🤣. I can't translate this. You have to be from rural kzn like me to understand. Oh also excludes anyone born after 2000. Sorry🙏 25/04/21 22:07 | South Africa | twitter.com Tweet

Anis Ahmed (Gen. Secretary, Popular Front) Everyone should read this..I hope some can translate it to Hindi and other languages so that the country knows about the Godi media are trying to protect the @narendramodi sarkar.. #ModiGovtSeNaHoPayega #WhoFailedIndia 25/04/21 22:06 | India | twitter.com Tweet

熊 | Aiko | アオペラ�� Yams's Interview Levi's special Magazine FRAU NO.468 August 2014 Levi-centric feature. I'll translate things that are interesting for the readers. https://t.co/aAsaKEv55w 25/04/21 22:05 | Japan | twitter.com Tweet

INTO1 fan account INTO1 #ZhouKeYu Weibo update📍 I am sorry guys this is too long so I'll just translate the first and last part #周柯宇 #创造营2021 #CHUANG2021 #INTO1 #INTO1Debut https://t.co/MxuQcJYq0X 25/04/21 21:58 | China | twitter.com Tweet

Dims ✨ When you sit and think of how our little TV show, on May 28th, is going to give the world a full-blown interaction between God and his fallen angel, and will translate it into an understandable, raw, human emotional level. Wow. Unmatched. #LuciferSeason5 25/04/21 21:57 | United States | twitter.com Tweet

Rachit Seth In this crisis. It is the young who are using whatever means to help. Complete strangers. Circulating. Amplifying. Caring. Keeping the flame of hope alive. They are also angry. Don't know whether this anger will translate to something tangible. But they deserve our appreciation. 25/04/21 21:49 | India | twitter.com Tweet

Y̶Y̶｡*☆♡ Nene: I know I need to continue learning chinese. I can hold conversations, but I still cant express a lot of emotions. Don't worry! My baby ne.... :( tearing up as I translate #เนเน่ #YYLivexNENE 25/04/21 21:40 | United States | twitter.com Tweet

–a¡lo �� adh gw klw jago bakor nie video si yusril dha gw translate trs gw laporin ke kq dha mmpuez lw 25/04/21 21:40 | United States | twitter.com Tweet

‎ؘ will translate keyu's post now 😭 25/04/21 21:32 | United States | twitter.com Tweet

Ruby The Magnificent I hope someone translate this🥰💙💕 #DarkbluekissRerunEp5 ctto https://t.co/JSI6Yf9qXf 25/04/21 21:23 | United States | twitter.com Tweet

ON - OPEN DM �� 📻 translate indonya. Terharu kq sampe mikirin mental health penggemar juga 🥺 https://t.co/HLM92RAALi 25/04/21 21:20 | Monaco | twitter.com Tweet

booralo�� MY MAN PULLED OUT THE WHOLE GOOGLE TRANSLATE 😂😂 LUCA WE LOVE YOU #VincenzoEp18 #Vincenzo https://t.co/NGsZo358TN 25/04/21 21:20 | United States | twitter.com Tweet

✨ Joey Acá está mi trasnoche de ayer: ¡el buscador de ideas de #WebConfLATAM 2021! Nos basamos en los tópicos de GitHub y mucho Google Translate para sugerirte 480 opciones posibles de temas para poner esas neuronas creativas a hacer sinapsis 🧠🤯 25/04/21 21:17 | Spain | twitter.com Tweet

Panda Editing and Translating Services @BrennanHarvey @JessSFrankel Is it time for a new marketing strategy TO THE WORLD that can increase your readers 100%? Why not have your book translated to Spanish? Contact the Panda for more information! #Translate https://t.co/o1YvQzM0Si https://t.co/NYd3vPYwwr https://t.co/EF7DjTdLgJ 25/04/21 21:15 | United States | twitter.com Tweet

َ [210425] 🐯💭 "i took the pictures pretty well, right? ㅎㅎ" t/n: he sent his messages a few hours ago, but we only got the time to translate them now! sorry! https://t.co/xYsLBQqcSg 25/04/21 21:14 | United States | twitter.com Tweet

EPEX Global [✉️ • FANCAFE • 21.04.25] KEUM • Letter. "First Letter". *translate with help of "daum cafe translation". @the_EPEX #EPEX #이펙스 • #KEUM #금동현 https://t.co/SZVD42EPkE 25/04/21 20:34 | United States | twitter.com Tweet

３子 すぐるくんとさとるくんの話(2/2) 捏造です。転載・翻訳禁止。 Fan Fiction. Don't repost. Don't translate. https://t.co/AsqrxcAExp 25/04/21 20:33 | Japan | twitter.com Tweet

３子 すぐるくんとさとるくんの話(1/2) 捏造です。転載・翻訳禁止。 Fan Fiction. Don't repost. Don't translate. https://t.co/paYqCDEVPu 25/04/21 20:32 | Japan | twitter.com Tweet

Leo P I also think #SFB mocks - while certainly useful - can lull folks to sleep a bit. Rarely do I see mock ADP translate accurately once the mock security bubble is burst and folks are faced with real time positional runs and a draft board in shambles. 25/04/21 20:21 | United States | twitter.com Tweet

Xaddy Targaryen, Breaker of Walls �� Being in love is dangerous territory for me because I LOVE HARD.. and unfortunately that love doesn't always translate effectively 25/04/21 20:18 | United States | twitter.com Tweet

Italian ARMY⁷ | Theorist |��️ If ARMY all over the world come together to decipher and translate in Eng all the voice records, maybe we can find some other clues? There is also a korean one (you have to point at the bottom left). The Italian one talks about Galileo Galilei's life 🤔 https://t.co/M3F0Tblt7R 25/04/21 20:03 | Italy | twitter.com Tweet

Ohm Pawat Worldwide @mynameisnanon @ohmpawatt International fans reading the google translate: https://t.co/5TyoPoOXUP 25/04/21 19:53 | United States | twitter.com Tweet

Global Bilişim Derneği (BİDER) Thodex vakası sonrası sosyal medyada Thodex kripto para hesaplarının tespiti ve hesaplardaki hareketler İle ilgili bir çalışma başlattınız? Amacınız nedir? @SenolVatansever @bit_gossip @benguturktv @tufanpoyrazz #TeknolojiVeGelecek #Crypto #Bitcoin Translate Tweet 25/04/21 19:39 | Turkey | twitter.com Tweet

�� we don't hear him talk about LGC often omg. i hope somebody could kindly translate this interview if it's alright... i'd be really grateful @axelsandwich @shinjistarxx @string0310 @ShuPa93156524 https://t.co/K14s3HMTmc 25/04/21 13:38 | United States | twitter.com Tweet

Vinaya Pai ���� Jai Shree Ram �� @SecBlinken Translate: We will demand our pound of flesh. The main one? Resume funding of soul harvesters! 25/04/21 11:36 | United States | twitter.com Tweet

Ruby The Magnificent Kindly translate please dear @pathissaraNew thank you🙏🥰 https://t.co/tvGm77E9fi 25/04/21 09:29 | United States | twitter.com Tweet

I Am✨ No cap please dont ask me to translate it's embarrassing 😂😂😂 https://t.co/IZAePnPZ9J 25/04/21 08:27 | Mexico | twitter.com Tweet

Ong Kian Ming ���� How does one translate "tumpang glamour" to English? TJ, please help me! 25/04/21 07:03 | Malaysia | twitter.com Tweet

Senator Scott Surovell I can translate this older VA dialect in case you haven't heard it lately: "VA's Parole Board grants parole. I don't like parole. Dog whistle, dog whistle. I'm a tough guy. #MAGA-#MAGA-#MAGA. Leave Bill Barr's Truth in Sentencing plan alone!" @ACLUVA @JusticeFwdVa 25/04/21 04:21 | Canada | twitter.com Tweet

Ahmed Ammar How do we translate the '2020 ESC Guidelines on Atrial Fibrillation' into clinical practice? The 4S-AF scheme #EHRA2021 https://t.co/WHPLrSvu2C 25/04/21 02:01 | United Kingdom | twitter.com Tweet

wyatt japanese companies do not give a fuck about your feelings on the subject. They dont care about your dumb soy eating , funko pop collecting employees who im sure are paid way too much. We are not asking for much. Just translate the fucking shit and stop writing new scripts 25/04/21 01:10 | United States | twitter.com Tweet

IH Awareness Week .@Hyper_Sleep has created an exciting new #IdiopathicHypersomnia poster and we have started to translate it (see following tweets). You can download a PDF from here https://t.co/hYWjs0F1OW https://t.co/9ZBAkriJrw 23/04/21 22:16 | United States | twitter.com Tweet

Blogs 50 new results

Will lessons learned from this pandemic soften the blow during the next one? ...live in less expensive places than the cities where they once labored. That could translate into less traffic. Telemedicine is here to stay as well, enabling people in remote places to receive much better care. The pandemic also laid bare... 25/04/21 23:00 | United States | eastbaytimes.com Tweet

Howard University Students Protest Cut of Classics Department, Hub for Black Scholarship While growing up, she developed a passion for translating Latin and became fascinated with its role in biology. "Seeing Black people translate, with such proficiency, at a place of higher learning was something that I only experienced at Howard,"... 25/04/21 22:51 | United Kingdom | newslanes.com Tweet

Saturday April 24 2021 Twilight, Tim Allen, Paige was 6 in 2008. Language, communicating with landlords, Google Translate. More on the butt statue. American Visionary Museum. The last Blockbuster is in Oregon. The book Deeper Than The Dead by Tammy Hoag. Dr Seuss... 25/04/21 22:48 | United States | marvsmidlifemeanderings.blogspot.com Tweet

MLB DFS Picks, Stacks + Hitters for April 25, Yahoo, Draftkings, FanDuel While Jon Gray survives with Coors Field as his home park as a groundball pitcher, he too allows a fair amount of power. And though it does not always translate into longballs, the expansive outfield and the thin air of Denver leads to lots of... 25/04/21 22:46 | United States | awesemo.com Tweet

RICH INTERVIEWS: Liv Albert Author for The Gods, Goddesses, and Heroes Handbook ...things would have also been immoral to the people of ancient Greece, but it doesn't translate in the same way it would now. 1st: How do you like to spend any free time you have? Liv: Lately my whole life seems to revolve around Greek mythology, so... 25/04/21 22:38 | United States | firstcomicsnews.com Tweet

FDA to scrutinize unproven cancer drugs after 10-year gap approves dozens of new uses for cancer drugs based on early signs that they can shrink or slow the spread of tumors. But how often do those initial results translate into longer, healthier lives for patients? That seemingly simple question is one... 25/04/21 22:27 | United States | earthinfonow.com Tweet

Android simultaneous animation and video playback ...id.com/apk/res/android" android:fillAfter="true"> <translate android:fromXDelta="100%p" android:toXDelta="0%p" android:duration="2000"/> <translate android:startOffset="3500" android:fromXDelta="0%p" android:toXDelta="-100%p"... 25/04/21 22:19 | United States | stackoverflow.com Tweet

George Smith (1914-1978) the joiner who built a union – Society for the Study of Labour History George had long believed that a full-time executive council was an anomaly but it was not feasible then to translate that belief into practice. As a result, he had to work with a much enlarged executive council until its membership was reduced over... 25/04/21 22:16 | United Kingdom | sslh.org.uk Tweet

Florida Panther Sam Bennett Adjusting Well to New Home in Sunrise Forcing the other team's defenseman to make mistakes and create turnovers will translate to more offensive chances for his linemates. Huberdeau is a wizard with the puck. You legitimately never know what he is going to do with it. While on the... 25/04/21 22:13 | Canada | lastwordonsports.com Tweet

Watford 1 Millwall 0 (24/04/2021) ...that nostalgia for something lost can translate into enjoyment of something alive. And besides, some of this alienation –... 25/04/21 22:09 | United States | bhappy.wordpress.com Tweet

bodybuilding workout: Do You Really Need It? This Will Help You Decide! The problem is that most research has been conducted on horses, rats, and other animals, so it's hard to tell how those findings translate to humans. Learn more about how this medication works and what you need to know if you want to stop taking…... 25/04/21 22:07 | Greece | syntagestisgogos.gr Tweet

Optimism Builds on Infrastructure Proposal | Beyond Basic Beta Channel Steel equities rose sharply in anticipation of the massive global infrastructure spending that should translate into considerable demand for steel. Sustainable energy continued to selloff in March as higher interest rates pressured companies with... 25/04/21 22:00 | United States | etftrends.com Tweet

Lil Kim Performs at Florida Aids Walk with Daughter Royal Reign and Trina in Custom Geche Escvar... ...<g stroke="none" stroke-width="1" fill="none" fill-rule="evenodd"><g transform="translate(-511.000000, -20.000000)" fill="#000000"><g><path d="M556.869,30.41 C554.814,30.41 553.148,32.076 553.148,34.131 C553.148,36.186 554.814,37.852 556.869,37.852... 25/04/21 21:56 | United States | fashionbombdaily.com Tweet

God is Love – Blake T. Hart In spite of the fact that Jesus said nothing about homosexuality. In spite of the fact that the word we translate as "homosexual" in the Bible doesn't really mean that. Meanwhile. God.is.love. They will know we are followers of Christ by the way... 25/04/21 21:49 | United States | blakethart.com Tweet

How I Kickstarted My Dev Career by Doubling Down on My Education Debt ...start date and earlier access to promotions. In most cases, this acceleration will translate to a larger financial benefit across an entire career than the initial cost of the boot camp course fees. Discipline For all the advantages boot camps... 25/04/21 21:46 | Tonga | dev.to Tweet

Malcolm Koonce 2021 Nfl Draft Profile Generating edge pressure is so vital to success in the NFL. Teams have to take a long look at Koonce whose pass rush traits should translate well to the NFL. The step up to the NFL will be a challenge. There's the precedence of Khalil Mack coming... 25/04/21 21:45 | Canada | lastwordonsports.com Tweet

UK volleyball: National championship caps unprecedented season ...in almost every other sport, there were questions about how that success would translate to the national level. Kentucky's dominant run to the title ends those doubts and backs up the confidence of Lilly and fellow senior Gabby Curry, a third-team... 25/04/21 21:31 | United States | eu.courier-journal.com Tweet

The best Mod of WhatsApp in Market ...contacts at a time. 100+ language support Translate messages into different languages Changing themes, Font Send 90 images... 25/04/21 21:23 | United States | anmolgogia.wordpress.com Tweet

De Covid-19 reis naar de globalisering van de wereld (1) — Geef Mij je liefde | BIBLESPACE – BIJBEL... Nieuwsbrief van Franklin ter Horst, 09-11-2020 To translate his newsletter into different languages, click here Covid-19 is niet de naam van een virus maar de codenaam van een internationaal plan voor de controle en... 25/04/21 21:18 | Canada | biblespace.org Tweet

Tâm tình cùng nhạc sĩ Phan Văn Hưng ...hiểu nội dung các bài hát, kiếm lời Việt rồi sử dụng Google translate sang tiếng Anh. Tôi phá lên cười, "Chết rồi, ông Google translate bài 'Hai mươi năm' vậy mà ông vẫn ưa được cơ à?" Phạm Phú Khải: Thế còn bài "Em Bé và Viên Sỏi"? Phan Văn Hưng... 25/04/21 21:18 | Vietnam | nguyenhuuhop.blogspot.com Tweet

Full seven-round NFL mock draft (with trades!) with a Cowboys focus ...Georgia's hybrid defense, which will translate very well to the varied fronts Miami uses under Brian Flores. One of the... But Adebo has great traits that directly translate to the Cowboys' new scheme. Dane Brugler of The Athletic had this to say... 25/04/21 21:00 | United Kingdom | bloggingtheboys.com Tweet

Slipknotin Clown selventää tavallaan, miksi yhtye ei ole päättänyt soittaa striimikeikkaa... We don't even understand what the hell's going on with our own problems as humans, let alone try to put together a livestream and make it translate to someone like you who wants it so badly in the room you're in. I take that very, very, very, very... 25/04/21 20:40 | Finland | kaaoszine.fi Tweet

rob mclennan's blog: Roxanna Bennett, The Untranslatable I ...affect. Are you pretty, are you smiling? Translate: go quietlyor we'll replace you with a replica skeleton. Roxanna ... puts in their ears to simultaneously translate spoken language as it moves through the ear, from Douglas Adams' infamous... 25/04/21 20:31 | United Kingdom | robmclennan.blogspot.com Tweet

Maximus and Me: Project CETI - Using AI To Decipher Whale Language ...apply advanced machine learning and state-of-the art robotics to listen to and translate the communication of whales. Founded and led by a team of scientists, CETI is bringing together leading cryptographers, roboticists, linguists, AI experts... 25/04/21 20:29 | United States | maximusandme.blogspot.com Tweet

Tâm tình cùng nhạc sĩ Phan Văn Hưng ...sử dụng Google translate sang tiếng Anh. Tôi phá lên cười, "Chết rồi, ông Google translate bài 'Hai mươi năm' vậy mà ông... 25/04/21 20:09 | Vietnam | nhatnguyet2014.wordpress.com Tweet

Behr Paint Color Cards - Https Encrypted Tbn0 Gstatic Com Images Q Tbn... com may not match the colors you ultimately paint on your surface.' | translate }} {{ 'for true color representation, always ... to confirm the color in your home.' | translate}} Consumer reports does not endorse products. Each chart has five different... 25/04/21 19:41 | United States | dasshicksal.blogspot.com Tweet

How Did We Get There? The History Of natural bodybuilding competitions Told Through Tweets The problem is that most research has been conducted on horses, rats, and other animals, so it's hard to tell how those findings translate to humans. Sleep longer than usual on the night after a workout. If you're still on Plan A after weeks, try... 25/04/21 19:39 | Vietnam | amala.vn Tweet

Career Objective For Resume For Business Management : How To Write A Career Change Resume Jobscan... comA resume objective helps the reader understand how your skillset from a previous field helps translate. Source: www.jobscan.coI take a people first approach to management while holding my team to high standards and ensuring i. Source... 25/04/21 19:31 | United States | expresso-anode1890.blogspot.com Tweet

NBA Draft 2021 Austin Reaves Scout Report Heaven Version of Austin Reaves The three improves drastically, handle and shot creation translate. Is able to become a decent team defender. 14-4-4 with 40% from three Hell Version of Austin Reaves A player that can offer a lot offensively in... 25/04/21 19:28 | United States | what-to-consume.com Tweet

All Weather Floor Mats Floor Liner for 20152019 Chevrolet 04.12 Translate Our allweather floor mats and liners will shield your carpet from damage. Custom fit floor mats and liners provide the most complete protection. Theyre designed to conform to the floor Minggu, 25 April 2021 25/04/21 19:12 | United States | car-accident-pictures-4u.blogspot.com Tweet

Un Juego Organizado / Juego Organizado : Cómo hacer un juego lanzabolas fácil | pequeocio. Comprar un mazo nuevo antes de empezar elevento para jugar). Need to translate juegos organizados from spanish and use ... wargames y juegos de miniaturas. Need to translate juegos organizados from spanish and use correctly in a sentence? Elija un... 25/04/21 19:00 | Spain | familiarochasc.blogspot.com Tweet

Beauty talk, Mercury conjunct Venus | Tara Greene,Tarot Reader, Astrology Psychic The focus will be on the feelings and the emotional body. I will translate the planetary aspects into easy-to-understand... 25/04/21 18:43 | United States | infinitynow.wordpress.com Tweet

2019 Chevrolet Tahoe vs 2019 Chevrolet Suburban Whats 03.30 Translate En 2015 le Chevrolet Tahoe de Minggu, 25 April 2021 25/04/21 18:30 | United States | car-accident-pictures-4u.blogspot.com Tweet

Flutter project doesn't open on Chrome ...bwsi --no-first-run --no-default-browser-check --disable-default-apps --disable-translate http://localhost:13570 Flutter doctor -v [√] Flutter (Channel stable, 2.0.5, on Microsoft Windows [Version 10.0.19042.867], locale en-US) • Flutter version... 25/04/21 18:11 | United States | stackoverflow.com Tweet

Beheerders voor domein in zuid Frankrijk (Gard) gezocht Goede beheersing van Franse taal noodzakelijk omdat meeste gasten frans zijn. Eigenaresse is ook Française dus graag in het frans reageren (geen google translate vertaling) Steven... 25/04/21 18:09 | Netherlands | nederlanders.fr Tweet

2021 Chevy Tahoe Rst Colors At4 And Dimensions Mpg 02.58 Translate The 2021 Tahoe is all new and considerably improved. Along with a completely redesigned exterior and interior design the threerow SUV has been stretched to... 25/04/21 17:58 | United States | car-accident-pictures-4u.blogspot.com Tweet

When sleepiness enters the therapy session In the same way if a powerful emotion like anger is being "held under the water" it has an effect on the energy in the room and that can translate into me feeling sleepy. This can also happen in the individual's own life – disowned anger can lead... 25/04/21 16:49 | United States | patrick-mccurry.com Tweet

Despite racial reckoning, state efforts stall on reparations approves dozens of new uses for cancer drugs based on early signs that they can shrink or slow the spread of tumors. But how often do those initial results translate into longer, healthier lives for... 25/04/21 16:40 | United States | mytwintiers.com Tweet

Timberwolves Top Jazz 101-96 Thanks To All-Around Effort From Edwards It helped him get out in transition and attack the rim for multiple easy baskets. "Anything I do defensively is going to translate on the offensive end," Edwards said. Karl-Anthony Towns had 24 points and 12 rebounds, and D'Angelo Russell added... 25/04/21 16:25 | United States | minnesota.cbslocal.com Tweet

Why "Going Wide" Can Work for Authors If I'm going to polish and publish a book, I want to make money. Going wide lets me make more, and that's the big pro. How Did Going Wide Translate to More Readers? In theory, more places to sell should mean more books sold, but it did not happen... 25/04/21 16:10 | United States | elaineorr.blogspot.com Tweet

🚀 Los Mejores Traductores Online Gratuitos ...y permite trabajar con 104 idiomas diferentes empleando la tecnología de Google Translate. Tradukka Esta web realiza la traducción en tiempo real, es decir, a la vez que se introduce el texto, se va adaptando el resultado final. Cuenta con... 25/04/21 16:00 | Spain | xn--muozparreo-u9ah.es Tweet

Should Navarrete move up in weight? Did Berlanga benefit from his KO streak ending? ...more than fellow titleholder Gary Russell Jr.) and it seems clear his power would translate even if he moved up to junior featherweight, a move he's flirted with recently. So what's the best career move for Navarrete? Stay at featherweight, where he... 25/04/21 15:50 | Canada | worshipmedia.ca Tweet

FDA to scrutinize unproven cancer drugs after 10-year gap approves dozens of new uses for cancer drugs based on early signs that they can shrink or slow the spread of tumors. But how often do those initial results translate into longer, healthier lives for patients? That seemingly simple question is one... 25/04/21 15:41 | United States | mytwintiers.com Tweet

FDA to scrutinize unproven cancer drugs after 10-year gap approves dozens of new uses for cancer drugs based on early signs that they can shrink or slow the spread of tumors. But how often do those initial results translate into longer, healthier lives for patients? That seemingly simple question is one... 25/04/21 15:34 | United States | informnny.com Tweet

The scientology tv show leah remini Diaries ...shows. Individual independence is a very important notion in my religion, and I translate that to sexual orientation. If we're all supposed to have the best to your everyday living that we wish to guide, then That ought to utilize on the gay... 25/04/21 15:25 | United States | lea-remeni34328.blogolize.com Tweet

FDA to scrutinize unproven cancer drugs after 10-year gap approves dozens of new uses for cancer drugs based on early signs that they can shrink or slow the spread of tumors. But how often do those initial results translate into longer, healthier lives for patients? That seemingly simple question is one... 25/04/21 14:37 | United States | ourquadcities.com Tweet

Best eCommerce Platforms (Get Started In Minutes) • Benzinga To help your business adapt to an international audience, Wix Multilingual lets you translate your store into 90+ languages. Pricing: Wix has 3 ecommerce plans: Business Basic starts at $23 per month Business Unlimited starts at $27 per month... 25/04/21 14:19 | United States | benzinga.com Tweet

Las Vegas Raiders: Ten 2021 NFL Draft Sleepers to know But the size (6'1, 210lbs), strength, hands, and explosiveness are things that can translate to the NFL nicely.rnrnOn day three, he is the type of prospect you take because the potential isn't even close to being tapped. Palmer could quickly end up... 25/04/21 13:00 | United States | justblogbaby.com Tweet

bodybuilding gym manchester Abuse – How Not To Do It The problem is that most research has been conducted on horses, rats, and other animals, so it's hard to tell how those findings translate to humans. As long as you consume a sufficient variety of incomplete proteins to get all the required amino... 25/04/21 08:08 | India | coffeeforcause.in Tweet

I Promised You The Moon: Divulgados pôster e título da sequência de "I Told Sunset About You" ..."Melhor Série", "Melhor Roteiro Original", "Melhor Trilha Sonora Original" (Can't Translate – Billkin), "Melhor Diretor" (Boss Kuno), "Melhor Ator Coadjuvante" (Nat Kitcharit), "Melhor Coprotagonista" (Khunpol Pongpol) e dois de "Melhor Ator... 24/04/21 23:00 | Brazil | sucodemanga.com.br Tweet

Discussions 50 new results

wsr/ - Could a fluent speaker translate the Cory in the H - Worksafe Requests - 4chan Anonymous 04/24/21(Sat)23:52:19 No.1014154 File: 1563162783289.jpg (61 KB, 1024x683) 61 KB JPG Anonymous 04/24/21(Sat)23:52:19 No.1014154 Could a fluent speaker translate the Cory in the House theme song lyrics into Japanese? 26/04/21 05:52 | United States | 4chan.org Tweet

Hidden margins either side of screen b $bfe001,d5 ;/FIR1 /FIR0 /RDY /TK0 /WPRO /CHNG /LED OVL bsr Player_ReadControlsOne ;Process Joy 1 move.l (sp)+,d1 rts Player_ReadControlsOne: ;Translate HV data into joystick values moveq #0,d0 moveq #0,d1 moveq #0,d3 moveq #0,d4 ; -- Get the 4... 25/04/21 20:19 | United States | eab.abime.net Tweet

[TOMT] What do you call someone that works with making online lexicons/dictionarys? Like the people making Google Translate, or Dictionary.com 25/04/21 19:24 | United States | reddit.com Tweet

Minimalsim itself doesn't bring happiness. But what does? It lets you focus on the important stuff in life and gives your life value, which should translate to happiness at some point. I found myself in a state where I feel just lost. I don't want to pursue a career, because then I dont have enough time... 25/04/21 19:03 | United States | reddit.com Tweet

Can OCD appear suddenly or is it more likely to have tendency towards it? Mentally it just has to be right in my head, it needs to feel right and with any doubt, I can't or don't. This probably doesn't translate to actual OCD, but just to say that that perfectionist and obsessive component has been there a long time... 25/04/21 18:38 | United States | reddit.com Tweet

[ENG > JAPANESE] help translating names How would you translate the following names to Japanese: Joshua, Max, Squishy (this is a nickname I go by) Any help would be appreciated! :) 25/04/21 18:29 | United States | reddit.com Tweet

Casual turned Diehard C-Fan/I-Fan's Thoughts (leading up to finals/debut lineup) And then I plan on finishing Rap for Youth and TCO4 (hopefully before INTO1 stuff comes out) . I also want to translate more of AK's music into english and post it on twitter (rip me and the hate that I'll get but it's alright, I'm determined), to... 25/04/21 18:08 | United States | reddit.com Tweet

Why are the English words for countries so varied from what the country calls themselves? Is it a different case for each country or is there some general rule about how to translate countries... 25/04/21 17:42 | United States | reddit.com Tweet

please translate this https://i.redd.it/t8i2oi7nfav61.png 25/04/21 17:25 | United States | reddit.com Tweet

5 Substitutions Actually I really hope that they make rule changes in the real world to have the 5 Substitutions moving on, because all the benefits in FM translate to real football as well and with the new UEFA CL reforms and even more games for the players I... 25/04/21 17:24 | United States | reddit.com Tweet

How do you thin paint precisely? ...keep seeing all these percentages 80% paint 20% thinner etc etc, but how do you translate that to quantity? Do you eyeball it? I wanna paint a ship and I was hoping the tamiya spray cans would be available but no, so the other solution is the... 25/04/21 17:04 | United States | reddit.com Tweet

My Pantheon for Ghosts of Saltmarsh ...entities exist, but aren't commonly known. Now on to some lore! (I'm using deepl to translate my notes into english, so please excuse some inconsistencies) **The Beginning and Tiamat:** *In the beginning, Tiamat was alone. In her loneliness, she was... 25/04/21 16:43 | United States | reddit.com Tweet

Faiz just got released legally in the US! That's why I said poorly copied from a google translate. Like if they did text to speech but were listening from another room where a party was going on. 25/04/21 16:41 | United States | reddit.com Tweet

interested in websites that watch Blu-ray Gundam works online? ...will be very slow). https://share.gundam.wiki If someone is willing to help me translate the work introduction in English, please join the Telegram group: [https://t.me/GUNDAM\_HANGAR](https://t. me/GUNDAM_HANGAR) The creation of this website is not... 25/04/21 16:37 | United States | reddit.com Tweet

From Samsung A3 (2017) to S9 or ??? I'm not a gamer, nor (intend to) do fancy stuff on my phone. Just basic messaging, banking, maps/directions, translate, shopping list, simple games, etc. I think a used/refurbished S9 would be fine and will last me a few years. I read the battery... 25/04/21 16:37 | United States | reddit.com Tweet

g/ - Fuck Google - Technology - 4chan * Spread this guide to relatives and acquaintances. Especially on Whatsapp and/or Facebook groups. * Eventually translate this guide into your own language. REASONS * Prevention of remote study of the area by attackers (thieves). * Protection of... 25/04/21 15:56 | United States | 4chan.org Tweet

12 Monkeys Steelbook (from Zavvi) -- bit of weirdness... 99 CAD$** \-- however staying on US site, but change only the currency to US$, and all of a suddent it's now $24.99 US ... which will translate (from my bank) to about $32 Canadian. &amp;#x200B; TL:DR So... Any Canadians looking for the [12 Monkeys... 25/04/21 15:55 | United States | reddit.com Tweet

[year 11 physics: laser cooling to absolute zero] : Science Words Translation Needed! ...parts of it, I don't understand the method that the report outlines. Is anyone able translate then contents of the report? Heres the link to the report... 25/04/21 15:52 | United States | reddit.com Tweet

Found this at Phoenix Mall, Chennai. Pretty sure they used Google Translate to get it in Malayalam. https://i.redd.it/2xf3t6wmy9v61.jpg 25/04/21 15:49 | United States | reddit.com Tweet

translate please: translate please: Mon denier jour d'école The memory of my last day of school is very sad and happy it reminds me of all the sweet memories and sad feelings. I'm very... 25/04/21 15:48 | United States | reddit.com Tweet

[Japanese>English] How to translate this word? 位置情報連動 25/04/21 15:45 | United States | reddit.com Tweet

Is there an exchange rate from points to dogecoin? Hi, i recently started folding on 2 computers, the one with a nvidia geforce gtx 750 is estimated to yield 24k points on the current work unit, and is estimated to yield 60k per 24h. how does that translate into DOGE? 25/04/21 15:18 | United States | reddit.com Tweet

...what is says. If anyone could translate the characters or tell me what language it is so I can... https://i.redd.it/k9igm8bjr9v61.jpg 25/04/21 15:11 | United States | reddit.com Tweet

Ammo manipulation on H3 ...it doesn't have a touchpad. Can anyone help me? Are there certain controls that translate differently on the quest or just don't... 25/04/21 15:08 | United States | reddit.com Tweet

Jaipur Dialogues is looking to translate "Fatawa Alamgiri", set of books compiled during Aurangzeb's... Even in English, it is not available except one or two volumes. &gt;It is a voluminous text and would require many years of labour to translate. We have set up a team to do a Hindi translation. The expenses would go to the tune of nearly 50 lakhs... 25/04/21 14:56 | United States | reddit.com Tweet

Pls say 1. Go to [this](https://www.reddit.com/r/WorldsFR VR/comments/mtviwf/build_contest_46_small _build_fantastic_tales_500/) thread. 2. Using Google Site Translation, translate it. 25/04/21 14:44 | United States | reddit.com Tweet

My first episode from Moldova - Thanks to those here who helped me translate some of the Russian https://youtu.be/eEIz09bd18k 25/04/21 14:38 | United States | reddit.com Tweet

Time to bonk Google Translate again! XD She wrote oppai as oppeh and I guess GTL read it as o pee. 25/04/21 14:34 | United States | reddit.com Tweet

Here are my personal predictions for the Resident Evil Collab. Mainly because the dynamic he had with Jill in RE3 where he'd chase her and she'd have to outrun and outwit him would translate well into DBD. As for his title, well, he was called that in the original RE3 so that works out. The map will either be... 25/04/21 14:25 | United States | reddit.com Tweet

i made a picrew picture and edited it so i'm flipping off the camera yeah I had the translate feature so it was easy to navigate 25/04/21 14:15 | United States | reddit.com Tweet

go ahead, translate beak into spanish [Thine] sole name blisters our tongues. *** ^(Insult taken from Macbeth.) Use `u/Shakespeare-Bot !ShakespeareInsult` to summon insults. 25/04/21 14:11 | United States | reddit.com Tweet

Can we talk about the acting of the soc characters or maybe the writing actually ...capture the complexity that is kaz brekker which i understand is very difficult to translate on screen. In the show kaz looks very generic and is reducing to a normal sassy threatening boss who is so much more. And can we just point out how the cane... 25/04/21 14:10 | United States | reddit.com Tweet

Hi, could someone please translate these two? http://www.reddit.com/r/kanji/comments/my 20x4/hi_could_someone_please_translate_th ese_two/ 25/04/21 13:54 | United States | reddit.com Tweet

everyone in my life expects big things from me, but I'm probably the dumbest person I know. ...have no game or looks to speak of. sure I have good grades, but what does that translate to in the real world? I feel like that's the only thing i have and without that I'm just a useless, deeply flawed person, and I don't have the heart to tell... 25/04/21 13:45 | United States | reddit.com Tweet

[English > Japanese] "The gentle side of an Oni" I'm looking to properly translate the phrase "The gentle side/ face of an Oni" into japanese. Google translate says its " 鬼の優しい面", but I don't know if it would correctly represent the message. Thanks in advance :) 25/04/21 13:30 | United States | reddit.com Tweet

[Korean > English]Could someone help me translate these two images? Thank you! http://www.reddit.com/r/translator/commen ts/my1o88/korean_englishcould_someone_hel p_me_translate/ 25/04/21 13:28 | United States | reddit.com Tweet

Can anyone help decipher and translate the Slovene on the back of this old family photo? [HERE](https://imgur.com/a/VhxfY1t) is the text in question. It's on the back of a very old (probably early 1900s) family group photo. I found this in a group of pictures of the Slovene side of my family, so I'm assuming this is a postcard sent from... 25/04/21 13:22 | United States | reddit.com Tweet

My Name is Yoshikage Kira except i put it through google translate 33 times ⠀⠀⠀⠀⠀⠀⠀⣠⣤⣤⣤⣤⣤⣄⡀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⢰⡿⠋⠁⠀⠀⠈⠉⠙⠻⣷⣄⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⢀⣿⠇⠀⢀⣴⣶⡾⠿⠿⠿⢿⣿⣦⡀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⣀⣀⣸⡿⠀⠀⢸⣿⣇⠀⠀⠀⠀⠀⠀⠙⣷⡀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⣾⡟⠛⣿⡇⠀⠀⢸⣿⣿⣷⣤⣤⣤⣤⣶⣶⣿⠇⠀⠀⠀⠀⠀⠀⠀⣀⠀⠀ ⢀⣿⠀⢀⣿⡇⠀⠀⠀⠻⢿⣿⣿⣿⣿⣿⠿⣿⡏⠀⠀⠀⠀⢴⣶⣶⣿⣿⣿⣆ ⢸⣿⠀⢸⣿⡇⠀⠀⠀⠀⠀⠈⠉⠁⠀⠀⠀⣿⡇⣀⣠⣴⣾⣮⣝⠿⠿⠿⣻⡟ ⢸⣿⠀⠘⣿⡇⠀⠀⠀⠀⠀⠀⠀⣠⣶⣾⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⡿⠁⠉⠀... 25/04/21 13:09 | United States | reddit.com Tweet

[18m]I'd like to defeat wall of fresh with you. Why not play terraria untill into hardmode. I want to play it with new character in new world. I need may 4 players. I have discord.but i can't speak english. I don't know how to multiply but i will just try. Thanks for translate. 25/04/21 13:06 | United States | reddit.com Tweet

How to change careers when you don't have the developed skills needed for that shift? I'm considering switching industries, as well. I just have no idea what my job could translate into or how to get the skills I need for other jobs. Any advice on how to figure any of this... 25/04/21 12:51 | United States | reddit.com Tweet

Did you know that in switzerland it is said that i International/Random 4chan ...would fit right in with the family's values concerning finances, which might even translate to a lot of other areas. It's... 25/04/21 12:34 | United States | 4chan.org Tweet

What does Grant says to Elliot (in mandarin) before shooting himself? Season 3 Ep 10 shutdown The barn scene unfortunately in Amazon prime the english subtitles doesn't translate that one sentence. 25/04/21 11:50 | United States | reddit.com Tweet

Dealing with Guilt. I never called him any names or put my hands on him, I was just so unbelievably upset that I felt like I couldn't translate what I was thinking to him. Why is it almost impossible for me to see how we both played a role? That we both retaliated... 25/04/21 11:10 | United States | reddit.com Tweet

Chinese learning tools The ones I'm using right now are: - Line Dict, which isn't that accessible but manageable. - Google translate for some stuff. - MandarinSpot. - Youglish, pretty cool site to look up expressions spoken by real people. That's it. I'm particularly... 25/04/21 11:07 | United States | reddit.com Tweet

Trouble actually creating the music in my head ...chord progressions and riffs and drumming and everything, but I can't actually translate that into something tangible. Instrumentally, I am not very talented but I am working very hard on improving, and I don't have a singing voice but I understand... 25/04/21 11:02 | United States | reddit.com Tweet

Nietszche on Incompetent people using "the moral throne"reference from 33 laws of war. Example of how it is black and white &amp; how the negatives are seen as "virtudes" (idk how to translate that word to English) of the people with slave mentality. master morality vs slave morality +Wealth=-Greed -Poverty=+Humble +Social... 25/04/21 10:21 | United States | reddit.com Tweet

What musa needs right now - marketing Let's get it the adoption or at least the awareness it deserves! Wiki, discord to start. Additional videos too. And select popular works to translate into Musa are always key for building the ecosystem of a language, whether it be human languages... 25/04/21 09:01 | United States | reddit.com Tweet

hey so im playing tnt portable dx and i havent really gotten the hang of the submenus i know what each main menu button does but if someone could translate some of the submenus that would be amazing 25/04/21 08:09 | United States | reddit.com Tweet

Can someone translate this drive constantly getting disabled for me? Hi all I've got a 5tb Seagate drive that twice has become disabled from the array. I've done Smart tests on it which it days it has passed but when trying to rebuild array using the unraid guide to remove and then re-add, it at some point disables... 25/04/21 06:38 | United States | reddit.com Tweet

Translation Help Hi guys, so I am trying to translate this to french, could someone please correct me if i am wrong? - All indents are four spaces. - All indenting is done with spaces, not tabs. - All if, while... 24/04/21 08:10 | United States | reddit.com Tweet

Delete Alert Manage Alerts Create Alert

If you like our Alerts, please help us keep this service free by liking and following!